FASTQ (.fastq) File Format - Maple Programming Help

Online Help

All Products    Maple    MapleSim


Home : Support : Online Help : Programming : Input and Output : File Formats : Formats/FASTQ

FASTQ (.fastq) File Format

FASTQ file format

 

Description

Details on the FASTQ format

Notes

Examples

References

Description

• 

FASTQ is a plaintext format for storing biological sequences and associated quality scores. It is similar to the FASTA format but in addition to sequence data it includes a quality score for each sequence element.

• 

The commands Import and Export support this format.

• 

Import produces an n×3 Matrix. Each row corresponds with a sequence element in the file:

– 

the first column contains a sequence descriptor

– 

the second column contains the sequence itself

– 

the third column contains quality information

Details on the FASTQ format

• 

The FASTQ format employs the following standard IUB/IUPAC conventions for encoding protein or nucleic acid sequences as alphabetic characters. For details on this encoding, consult the FASTA format.

• 

The quality string assigns a quality score to each element of the sequence. Each score is encoded as a single ASCII character with a mapping defined by the FASTQ specification.

Notes

• 

Content-Type: chemical/seq-na-fastq

Examples

Import a DNA sequence from a FASTQ file.

Importexample/sample.fastq,base=datadir

Sequence1AACAGGGTTTGTTAAGATGGCAGAG;;7;<=>=<;;;;:979:;;;;988Sequence2CAATACACTGAAAATGTCGATGGAT;;;;;;<=>?@A?><;;;:-;3;83Sequence3CATACACAAACGCCTGAGCCTAGCA9393393;7;;;;;:::;;;:;;;9

(1)

References

  

Cock PJA, Fields CJ, Goto N, Heuer M, Rice PM. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research (2010) 38(6): 1767-1771, doi:10.1093/nar/gkp1137.

See Also

Formats

Formats,FASTA

Formats,GenBank