StringTools - Maple Help

Online Help

All Products    Maple    MapleSim


Home : Support : Online Help : Programming : Names and Strings : StringTools Package : Random Strings : StringTools/Random

StringTools

  

Random

  

return a random string

 

Calling Sequence

Parameters

Description

Examples

Calling Sequence

Random( len, alphabet )

Parameters

len

-

positive integer; length of string to generate

alphabet

-

(optional) string or symbol; restricts the characters that form the string

seed

-

(optional) integer; seed for the random number generator

Description

• 

The Random(len, alphabet) calling sequence generates a random string of a given length, with the option of restricting the characters that form the returned string.

  

The Random(len) calling sequence returns a string of length len whose characters are randomly distributed and in the numeric range 1..255. That is, any non-zero 8-bit character can appear, and all appear with equal likelihood.

  

If the second optional argument, alphabet, is included in the calling sequence, it specifies the "alphabet" upon which the random string is generated. This option can assume one of two forms. If it is of type string, then the characters in that string are taken to be the alphabet from which to randomly draw characters in the output string. The alphabet characters must appear in US-ASCII order and cannot contain repetitions.

  

If the alphabet parameter is a symbol, then it must be one of the following recognized character class names.

Symbol

Range of Characters

 

 

alpha

A-Z or a-z

ascii

ASCII code 1 through 127

alnum

A-Z, a-z, or 0-9

binary

0 or 1

cntrl

FF, NL, CR, HT, VT, BEL, or BS

digit

0-9

dna

A,C,G or T

graph

alnum or punct

xdigit

0-9, a-f, or A-F

ident

A-Z, a-z, 0-9, or _

ident1

A-Z, a-z, or _

lower

a-z

octal

0-7

print

punct, alnum, or space character (" ")

punct

ascii and not in alnum, space, or cntrl

space

tab ("\t"), newline ("\n"), vertical tab ("\v")

 

form-feed ("\f"), or space (" ")

upper

A-Z

Examples

withStringTools:

lengthRandom100000

100000

(1)

lengthSelectIsAlphaNumeric,Random100000

24412

(2)

min,maxopconvertRandom100000,'bytes'

1,255

(3)

dnaRandom20,ACGT

dna:=CAGGAAGTTTCTCCTATGTC

(4)

Random20,'binary'

11000100001000110101

(5)

Random20,'upper'

FUWAOGIXUXHQIFZXZUQA

(6)

IsDigitRandom1000,'digit'

true

(7)

See Also

convert

length

max

min

op

rand

randomize

RandomTools

string

StringTools

StringTools[AndMap]

StringTools[IsAlphaNumeric]

StringTools[IsDigit]

type[string]

 


Download Help Document

Was this information helpful?



Please add your Comment (Optional)
E-mail Address (Optional)
What is ? This question helps us to combat spam