StringTools - Maple Programming Help

Online Help

All Products    Maple    MapleSim


Home : Support : Online Help : Programming : Names and Strings : StringTools Package : String Homology Routines : StringTools/LongestCommonSubString

StringTools

  

LongestCommonSubString

  

return the longest common substring of two strings

  

LongestCommonSubSequence

  

return the longest common subsequence of two strings

 

Calling Sequence

Parameters

Description

Examples

Calling Sequence

LongestCommonSubString( s1, s2 )

LongestCommonSubSequence( s1, s2 )

Parameters

s1

-

Maple string

s2

-

Maple string

Description

• 

A substring of a string S is a contiguous sequence of the characters appearing in S. The empty string is a substring of every string. A subsequence of a string S is a sequence of characters from S, which may not be contiguous in S. Every substring of S is a subsequence of S. For example, bc is a substring of abc, and ac is a subsequence of abc which is not a substring.

• 

The LongestCommonSubString(s1, s2) command returns from its input strings, s1 and s2, a common substring of maximum length.

• 

Many common substrings of maximum length may exist. Which among the candidates is returned depends upon the suffix structure of the pair of strings, but is deterministic.

• 

The LongestCommonSubSequence(s1, s2) command is similar, but searches for subsequences of the pair of input strings rather than substrings.

Examples

useStringToolsinLongestCommonSubStringabax,baxend use

bax

(1)

withStringTools:

LongestCommonSubStringtsaxbaxyz,axcaxy

axy

(2)

LongestCommonSubStringabcde,uvabxycde

cde

(3)

LongestCommonSubSequenceabcde,uvabxycde

abcde

(4)

LongestCommonSubStringabc,xyz

(5)

LongestCommonSubSequenceabc,xyz

(6)

seq1TAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGTGAGGCTCCCTCCCCTGCTCCGACCCGGGCTCCTCGCCCGCCCGGACCCAC:

seq2AAGCGCCGCGCAGTCTGGGCTCCGCACACTTCTGGTCCAGTCCGACTGAGAAGGAACCACCATGGTGCTGTCTCCCGCTGACAAGACCAACATCAAGACTGCCTGGGAAAAGATCGGCAGCCACGGTGGCGAGTATGGCGCCGAGGCCGT:

LongestCommonSubStringseq1,seq2

TGGCGAGTATGG

(7)

LongestCommonSubSequenceseq1,seq2

AAGGCCGCGCAGCTGGCGATTGGTCAGCCCTGGAAGGTGGGCTCTCCCCTGCTCGACCCGGGTCCGCCCGCGGACCCA

(8)

See Also

string

StringTools

StringTools[CommonPrefix]

StringTools[CommonSuffix]

StringTools[Levenshtein]

 


Download Help Document

Was this information helpful?



Please add your Comment (Optional)
E-mail Address (Optional)
What is ? This question helps us to combat spam